Biosynthesis of proteins, also known as translation, proceeds at ribosomes found to be large multi-c — Biochemistry Chemistry Question
Introduction to translation
Biosynthesis of proteins, also known as translation, proceeds at ribosomes found to be large multi-component supramolecular complexes composed of ribosomal RNA and proteins. The first stage of translation (referred to as initiation) includes assembling of large and small ribosomal subparticles together with messenger RNA (mRNA) as it is shown in Fig. 1.
[VISUAL]
Figure 1. General scheme of protein translation in a living cell
(http://www.biology4kids.com/files/cell_ribos.html)
Any amino acid is encoded by a codon, a sequence of three nucleotide residues in mRNA. How many codons do exist, if only four main ribonucleotides are taken into consideration? Do all codons encode amino acids?
Model Answer
There are 43=64 different three-nucleotide combinations of 4 nucleotides. Only 61 codons encode amino acids added to the growing polypeptide chain. 3 remaining combinations are STOP codons determining termination of the translation process.
Is it possible to derive a unique ribonucleotide sequence for a protein with a known amino acid sequence?
Model Answer
No, because of redundancy of the genetic code: most amino acids are encoded by several codons.
Amino acids are delivered to a functioning ribosome by a specific small RNA (referred to as transfer RNA, or tRNA). Each tRNA corresponds to a sole codon. How many different tRNAs can deliver an individual amino acid to ribosome? Consider leucine and methionine.
Model Answer
Leucine is encoded by 6 different codons, thus it is delivered to a ribosome by 6 different tRNAs. Being encoded by only 1 codon, methionine is transported by a sole tRNA. In some organisms the latter codon is also responsible for the translation start, encoding the N-terminal amino acid N-formylmethionine. Still, methionine and N-formylmethionine are transported by different tRNAs.
To be delivered to a ribosome, an amino acid should be covalently bound to its tRNA. This reaction requires energy provided by ATP hydrolysis and is catalyzed by aminoacyl-tRNA synthetase (aaRS), an enzyme specific for a particular amino acid. The side chain of the attached amino acid is not involved in covalent linkage with the tRNA. Write down equation(s) of the reaction(s) catalyzed by aaRS during the process of amino acid binding to tRNA. Indicate groups of the tRNA and amino acid involved in the linkage formation.
Model Answer
The equations of consecutive reactions are:
amino acid + ATP = aminoacyl adenylate + PPi (inorganic pyrophosphate) (1)
[VISUAL]
aminoacyl adenylate + tRNA = aminoacyl tRNA + AMP (2)
[VISUAL]
Thus, the carboxylic group of the amino acid reacts with 3’-OH group of its tRNA.
Using the table of genetic code write down amino acid sequences for the oligopeptides:
a) encoded by the hereunder mRNA
b) encoded by the hereunder mRNA with the first and the last C replaced by U
c) encoded by the hereunder mRNA with the first G replaced by C
d) encoded by the hereunder mRNA with the last but one G replaced by U
5'AUGGAUCACGCCAUCAAUGUUGUCGGUUGGAGUGUGGAUACGUUGGAUGAUGGAACUGAAGCU3'.
Model Answer
a) Met-Asp-His-Ala-Ile-Asn-Val-Val-Gly-Trp-Ser-Val-Asp-Thr-Leu-Asp-Asp-Gly-Thr-Glu- Ala or fMet-Asp-His-Ala-Ile-Asn-Val-Val-Gly-Trp-Ser-Val-Asp-Thr-Leu-Asp-Asp-Gly-Thr-Glu -Ala, depending on the biosynthesizing species (Eukaryotes, Prokaryotes, or Archaea).
b) The third amino acid is tyrosine, and the last one is valine. All the rest positions are the same.
c) The N-terminal amino acid is leucine. All the rest positions are the same. It should be noted that the translation in bacteria would not start without the START codon.
d) The last but one codon is changed into STOP codon, which will result in the oligopeptide shorter by 2 amino acid residues than that in i. 5a.
Write down the nucleotide sequence of mRNA encoding the peptide Met-Asp-Val-Asn-His-Pro-Glu-Tyr-Gly-Lys. Use A, U, G, and C for unambiguously decided positions, N1/N2 if any of two nucleotides is possible at a particular position, and N if any of four nucleotides is possible at a particular position (N1 and N2 can be any of A, U, G, and C).
Model Answer
AUG-GAU/C-GUN-AAU/C-CAU/C-CCN-GAA/G-UAU/C-GGN-AAA/G
Molecular weight of an E.coli protein is of about 51 kDa. Estimate the length of encoding mRNA (in nm, rounding to integer). Take the average molar mass of an amino acid as 110 g mol-1, and the average length of a ribonucleotide residue as 0,34 nm. How long will it take a cell to synthesize this protein if the ribosome reads 20 ribonucleotide residues per second?
Model Answer
The protein consists of 51000/110≈464 amino acid residues.
Hence, it is encoded by the mRNA containing 464*3+3=1395 nucleotide residues including the STOP codon.
The length of mRNA is 1395*0.34=474.3≈474 nm.
The time needed for biosynthesis of the protein is:
1395/20=69.7≈70 s, that is a bit more than one minute.
A group of researches accomplished protein synthesis in a cell-free system (in vitro). All required components (ribosomes, tRNAs, ATP, GTP, salts, amino acids, aaRS, translation factors, etc.) were added to the system. A synthetic polyribonucleotide consisting of only A and C in the ration of 1 : 5 was used as the messenger RNA (nucleotide residues are arranged randomly in the mRNA). Determine the amino acid composition of the synthesized protein. What are the ratios between the amino acid residues in the protein?
Model Answer
Taking into account that the A:C ratio is 1:5, the probability of finding A and C at any position is 1/6 and 5/6, respectively. Thus, the probability of finding certain codons is:
AAA =(1/6)3=1/216 CCC=(5/6)3=125/216
AAC=(1/6)2*5/6=5/216 CCA=(5/6)2*1/6=25/216
ACA=1/6*5/6*1/6=5/216 CAC=5/6*1/6*5/6=25/216
ACC=1/6*(5/6)2=25/216 CAA=5/6*(1/6)2=5/216
Using the table of genetic code one gets: Lys:Asn:Thr:Pro:His:Gln=1:5:30:150:25:5
The 3D structure of a tRNA is depicted in Fig. 2. There are two key regions: the CCA3’ terminus which is linked to the amino acid, and the anticodon exactly matching to the mRNA codon.
[VISUAL]
Fig. 2. The 3D structure of a tRNA
A mutant tRNATyr with anticodon specific to Ser codon (instead of Tyr codon) was introduced into the synthetic system described in i.8. What would be the resultant protein?
Model Answer
Anticodon has no influence on the CCA3’ terminus. Thus, the mutant tRNA will add tyrosine to the positions where serine was initially expected with respect to mRNA sequence. This may lead to improper folding of the protein and total or partial loss of its functional activity.
A biochemist specializing in protein chemistry described his discovery of a new mutant protein with Glu to His mutation to a molecular geneticist. The latter was very much surprised and advised the biochemist to do a double check. Why did the geneticist express a doubt concerning the possibility of the above mutation? What mutation is more probable?
Model Answer
Glu is encoded by GAA and GAG, and His by CAU and CAC. Two substitutions (of the 1st and 3rd residues) are needed to make this mutation true, which is quite improbable. Single residue mutations occur much more frequently, and Glu to Gln mutation can serve as an example (together with many other mutations of this type).