🧪 TheChemSolverInternational Chemistry Olympiad
Analytical ChemistryIChO

Borrow trouble for yourself, if that’s your nature, but don’t lend it to your neighbours Joseph RudyAnalytical Chemistry Chemistry Question

Intriguing translation

Borrow trouble for yourself, if that’s your nature,
but don’t lend it to your neighbours
Joseph Rudyard Kipling

An acyclic oligopeptide X is composed of residues of two proteinogenic (canonical, encoded) amino acids A and B. The prevalent ionic form of X in aqueous solution at pH 4.7 consists of 25 atoms.

23.1.

Determine the number of amino acid residues in X. Use the information provided by the Wikipedia at either http://en.wikipedia.org/wiki/Proteinogenic_amino_acid or http://en.wikipedia.org/wiki/Amino_acid (hint: pay attention to the given pKa values of amino acid side groups).

Model Answer

If X is an acyclic dipeptide, A and B should be composed of 28 atoms in total (25+3 for H2O). In the case of an acyclic tripeptide similar calculations lead to 31 atoms in total (25+6 for 2 H2O), this being true for any of two combinations of residues in the tripeptide (A+2B or 2A+B). Analysis of the structures of all proteinogenic amino acids given in Wikipedia suggests glycine as one with the minimal number of atoms (10) followed by alanine formed by 13 atoms. Thus, the tripeptide with the minimal number of atoms is composed of 2 glycines and 1 alanine. The total number of atoms (33) in the amino acids forming this tripeptide exceeds 31, which makes any tripeptide as well as large peptides impossible. Therefore, X is a dipeptide.

23.2.

How many individual peptides are in agreement with the above information?

Model Answer

Both α-carboxylic and α-amino groups exist mostly in the ionic forms at pH 4.7. Ionization state of the side groups at the given pH value should be determined individually based on their pKa values as reported in Wikipedia. One should leave into consideration only amino acids with the number of atoms less than 19 (28-10=18; this is maximal possible value in case one of two amino acids is glycine). According to the former weblink (http://en.wikipedia.org/wiki/Proteinogenic_amino_acid), only ten amino acids can be further considered: Gly (10), Ala (13), Cys (14), Sec (14), Ser (14), Asp (15), Pro (17), Thr (17), Asn (18), and Glu (18). These amino acids provide for the following dipeptides (without regard to N- and C-termini): Ser-Cys, Ser-Sec, Cys-Sec, Gly-Asn, Gly-Glu and Asp-Ala. Taking into account the residue positioning (N- or C-terminal), one gets two different dipeptides for each of the 4 former pairs, and 3 dipeptides for each of the 2 latter pairs (since the side chain carboxyl group of Asp or Glu can also be involved in peptide bond formation). Thus, the total number of dipeptides equals 14. However, because the side group of Asn is non-protonated at pH 4.7 (which is listed incorrectly on that Wikipedia page), the correct number of individual peptides is 12 (excluding Gly-Asn and Asn-Gly).

23.3.

Combustion of 1.000 g of X in an excess of oxygen followed by absorption of the reaction products with an excess of calcium hydroxide solution leads to formation of 3.273 g of precipitate. Quantitative transfer of the filtered precipitate into 10% aqueous hydrochloric acid results in liberation of 0.496 dm3 of gas (STP – standard temperature and pressure).

Draw the stereochemical structure of X supporting it by appropriate calculations. Specify the absolute configuration (R or S) of chiral centers in X.

Model Answer

Analyzing the five dipeptide variants, the correct answer corresponds to Cys-Sec (or Sec-Cys):
C6H12N2O3SSe + 9.5 O2 → 6 CO2 + SO2 + SeO2 + N2 + 6 H2O
Ca(OH)2 + CO2 → CaCO3↓ + H2O
Ca(OH)2 + SO2 → CaSO3↓ + H2O
Ca(OH)2 + SeO2 → CaSeO3↓ + H2O

Amount of substance of dipeptide: 1.000 g / 271.19 g mol-1 = 3.687 mmol.
Mass of precipitate: 3.687 * 10^-3 mol * (6 * 100.09 + 120.14 + 167.04) g mol-1 = 3.273 g.

Since the available data is insufficient to decide on the sequence of amino acid residues, both Cys-Sec and Sec-Cys are accepted as correct answers. Both amino acid residues (L-Cys and L-Sec) have the (R) absolute configuration at their chiral centers because the sulfur/selenium-containing groups have higher priority than the carbonyl group.

23.4.

Explain why A, in contrast to B, is not found as a free amino acid in living cells.

Model Answer

The –SeH group is a much stronger reducing agent than the –SH group. Thus, Selenocysteine (Sec, A) is very readily oxidized, which makes its presence as free selenocysteine inside a cell impossible.

23.5.

Addition of amino acid A to a growing polypeptide chain during translation is possible only in case of a certain motive (Element X) in the secondary structure of messenger ribonucleic acid (mRNA). Element X is a hairpin with two loops composed of approximately 60 nucleotides. Three such motives determining synthesis of glutathione peroxidase fragments in different organisms are schematically given hereunder (left to right: Poxviridae host cell infected with fowlpox, Poxviridae host cell infected with canarypox virus, and human cell).

[VISUAL]

Each square box in the pictures stands for a nucleotide residue with one of the canonical nitrogen bases: adenine (A), guanine (G), uracil (U) or cytosine (C). Hydrogen bonds are formed according to the complementary principle (Chargaff’s rule) between the bases with boxes opposite to each other. The only exceptions are:
* Nucleotides with boxes filled grey: pairs are formed by either two pyrimidines or these are unusual pairs A-C or G-U
* Nucleotides with boxes filled black: pairs are formed by two purines
* Nucleotides located in the middle of the upper loops and visually close to each other due to way of the hairpins representation.
The mRNA triplet (codon) identical for all three sequences is circled.
Fragments of mRNA sequences belonging to different organisms are given in the hereunder Table in an arbitrary order. These sequences contain Elements X depicted in the above images.

№ Nucleotide sequence (5´→3´)
1 …GCUGCUAAUGAAGAAAUGACUAUAAAUAGAUGGGUCAUGCCUGACACGCAAAG…
2 …AGGCACUCAUGACGGCCUGCCUGCAAACCUGCUGGUGGGGCAGACCCGAAAAUCCCAC…
3 …GACGAGAUAAUGAAGAAAUGGUCCUAAACAGAUGGGUCGUUCCUGACACCCCGG…

Fill the boxes in the images of all three structures, using one-letter symbols for nucleotides, and correlate the images with fragments of mRNA. Note that the sequences in the Table are bit longer than fragments corresponding to Elements X.

Model Answer

By analyzing sequence similarities and the specific purine-purine (black) or pyrimidine-pyrimidine/unusual (grey) base-pairing patterns, we find:
- Sequence 1 corresponds to the fowlpox virus hairpin structure.
- Sequence 2 corresponds to the Homo sapiens hairpin structure.
- Sequence 3 corresponds to the canarypox virus hairpin structure.

The circled codon in all three sequences is the UGA codon.

23.6.

Draw the unusual base pair guanine-uracil found in the hairpin structure, and show the hydrogen bonds.

Model Answer

Guanine-uracil is the so-called Wobble Base Pair. Hydrogen bonds are formed between the imino proton (N3-H) of uracil and the carbonyl oxygen (O6) of guanine, and between the imino proton (N1-H) of guanine and the carbonyl oxygen (O2) of uracil.

23.7.

What is the role of the encircled codon in the case of poxoviruses (but not humans!)? Note that the subsequent triplet determines inclusion of the next amino acid into the growing polypeptide chain. Choose only one answer.

№ Answer
1 It interacts with transport RNA of amino acid A
2 It determines termination of biosynthesis of the viral polypeptides on ribosome
3 It forms a “foot” of the lower loop thus playing a purely structural role
4 It is unable to interact with aminoacyl-tRNA. Thus the ribosome ignores it continuing addition of amino acids from the next codon
5 It is an ordinary codon without any special features

Model Answer

Variant 1 is the correct answer. The circled codon is UGA. While UGA is normally a STOP codon that terminates translation, in the presence of the SECIS (Selenocysteine Insertion Sequence) hairpin motif, it is read as a codon determining the inclusion of selenocysteine (amino acid A) into the polypeptide chain.

23.8.

For each of viral sequences, propose a mutation (single nucleotide substitution by another one), which presumably would not affect either translation or glutathione peroxidase functioning. Use the table of codons at http://en.wikipedia.org/wiki/Genetic_code.

Model Answer

The wild-type and mutant codons must encode the same amino acid, and the mutated nucleotides must not be involved in maintaining the secondary structure of the SECIS element (i.e., not involved in hydrogen bonding to opposite nucleotides). Thus, we can propose:
- For the fowlpox virus: U-23→С-23 mutation (both are tyrosine codons).
- For the canarypox virus: A-28→G-28 mutation (both are lysine codons).

💬
Still have doubts about this question?
Practice more questions like this, completely free.

Practice International Chemistry Olympiad questions like this — free

4,000+ questions across AP Chemistry, USNCO, and IChO — all free, no signup required.